Development of the identification's method of porcine endogenous retroviruses PERV-С

Abstract

The purpose of the work was to develop, optimize and develop a method for identification of endogenous retrovirus of pigs of the subtype C for assessing the level of biological safety of a potential donor material that is intended for xenotransplantation from pigs to humans.

The studies were carried out on DNA samples obtained from the blood of the Vietnamese Meyshan pigs (n = 10) and Large White pigs (n = 10). To isolate genomic DNA from venous blood samples the salt method was used. The main parameters of the obtained nucleic acids (DNA concentration, degree of purity and native nature) were measured using the NanoDrop-219 device. The genotyping was carried out by the method of allele-specific (PCR-SSP) multiplex polimerase chain reaction. Primers, complementary sections of the PERV-C locus were used [8], a fragment of the alpha-actin locus of domestic pigs (α-Actin) was used as the international control of PCR. 1. Structure of oligonucleotide sequences for identification of endogenous retrovirus of pigs of the subtype C: PERV-C (Forward: 5/- CTGACCTGGATTAGAACTGG -3/, Reverse: 5/- ATGTTAGAGGATGGTCCTGG -3/), α- Actin (Forward: 5/- CGCCATGTGTGACGAAGACGAGACC -3/, Reverse: 5/- CACGTACATGGCGGGCACGTTGAAG -3/). Electrophoretic separation of amplified DNA regions in a multiplex PCR was performed in a 2% wavelength gel. To control the size of fragments obtained as a result of amplification, a molecular weight marker, ThermoScientificO'GeneRuler 100 bp DNA Ladder was used.

As a result of a series of laboratory experiments to determine the optimal modes of amplification of PCR multiplex products of PERV-C-α-Actin, the following methodological parameters were derived:

1. To obtain specific products of synthesis of DNA – mixed, the reaction mixture for carrying out the reaction of the amplication with a total volume of 15 μl should have a working concentration of α-ActinLAPC-20 pMol / μl and PERV-C – 10 pMol / μl.
2. The amplification program for the created test-system in the format of multiplex is carried out in the temperature mode: 950С – 2 min; 35 cycles: 950 С – 30 s, 650S – 30 s, 720S – 3 min, 720S – 5 minutes.
3. Optimum component composition of the reaction mixture, calculated on the total volume of 15 μl (H2O-8 μl, 10xPCR-buf-1,6, dNTP-1,6, MgCl2-1,3, PrLAPC-FW-0,6, PrLAPC-RV-0,6, PrPERV-C-FW-0,3, PrPERV-C-RV-0,3, TaqPol-0,1, DNA-0,6).
4. Separation of PCR products should be carried out in 2% agarose gel, with the application of 10 μl of the PCR product and 3 μl of dye (bromophenol blue / xylolthianol). The duration of the electrophoresis passes about 30 minutes on the power of the electric field at 12 Watts.

Experimentally, a certain sensitivity of the PERV-C system on DNA samples of large white pigs (whose individuals, according to literature data, are predominantly carriers of the retrovirus subtype C), was detected using an already optimized and exhaust PCR scheme in the multiplex system. It has been shown that the dilution of the output DNA sample (1:1 to 152 ng / μl) to 1:10000 (15.2 pg / μl) is the maximum permissible for the detection of multiplex PCR PERV-C-α-Actin by the method of horizontal electrophoresis of 2% agarose gel.

According to the results of molecular-genetic genetic research, a system for diagnosing animal carriers of endogenous retrovirus of pigs of subtype C was developed using multiplex PCR-SSPPERV-C-α-Actin. The development and optimization of the genotyping technique for Vietnamese Meyshan pigs and Big White pigs determined the optimal parameters of PCR scheme, amplification program and modes of electrophoretic separation of fragments with their subsequent visualization, and also allowed to determine the maximum permissible concentration of DNA for PCR, which was 15.2 pg / μl, and the minimum amount of PCR product for its visualization is 5 × 10³ copies.