Development of the identification's method of porcine endogenous retroviruses PERV-С

  • T. M. Ryk Institute of Breeding and Animal Genetics nd. a. M.V.Zubets NAAS (Chubynske, Ukraine)
  • O. I. Metlytska Institute of Breeding and Animal Genetics nd. a. M.V.Zubets NAAS (Chubynske, Ukraine)
  • V. Y. Nor Institute of Breeding and Animal Genetics nd. a. M.V.Zubets NAAS (Chubynske, Ukraine)
Keywords: endogenous retrovirus of pigs, PERV-C, α-Actin, multiplex PCR-SSP, xenotransplantation

Abstract

The purpose of the work was to develop, optimize and develop a method for identification of endogenous retrovirus of pigs of the subtype C for assessing the level of biological safety of a potential donor material that is intended for xenotransplantation from pigs to humans.

The studies were carried out on DNA samples obtained from the blood of the Vietnamese Meyshan pigs (n = 10) and Large White pigs (n = 10). To isolate genomic DNA from venous blood samples the salt method was used. The main parameters of the obtained nucleic acids (DNA concentration, degree of purity and native nature) were measured using the NanoDrop-219 device. The genotyping was carried out by the method of allele-specific (PCR-SSP) multiplex polimerase chain reaction. Primers, complementary sections of the PERV-C locus were used [8], a fragment of the alpha-actin locus of domestic pigs (α-Actin) was used as the international control of PCR. 1. Structure of oligonucleotide sequences for identification of endogenous retrovirus of pigs of the subtype C: PERV-C (Forward: 5/- CTGACCTGGATTAGAACTGG -3/, Reverse: 5/- ATGTTAGAGGATGGTCCTGG -3/), α- Actin (Forward: 5/- CGCCATGTGTGACGAAGACGAGACC -3/, Reverse: 5/- CACGTACATGGCGGGCACGTTGAAG -3/). Electrophoretic separation of amplified DNA regions in a multiplex PCR was performed in a 2% wavelength gel. To control the size of fragments obtained as a result of amplification, a molecular weight marker, ThermoScientificO'GeneRuler 100 bp DNA Ladder was used.

As a result of a series of laboratory experiments to determine the optimal modes of amplification of PCR multiplex products of PERV-C-α-Actin, the following methodological parameters were derived:

  1. To obtain specific products of synthesis of DNA – mixed, the reaction mixture for carrying out the reaction of the amplication with a total volume of 15 μl should have a working concentration of α-ActinLAPC-20 pMol / μl and PERV-C – 10 pMol / μl.
  2. The amplification program for the created test-system in the format of multiplex is carried out in the temperature mode: 950С – 2 min; 35 cycles: 950 С – 30 s, 650S – 30 s, 720S – 3 min, 720S – 5 minutes.
  3. Optimum component composition of the reaction mixture, calculated on the total volume of 15 μl (H2O-8 μl, 10xPCR-buf-1,6, dNTP-1,6, MgCl2-1,3, PrLAPC-FW-0,6, PrLAPC-RV-0,6, PrPERV-C-FW-0,3, PrPERV-C-RV-0,3, TaqPol-0,1, DNA-0,6).
  4. Separation of PCR products should be carried out in 2% agarose gel, with the application of 10 μl of the PCR product and 3 μl of dye (bromophenol blue / xylolthianol). The duration of the electrophoresis passes about 30 minutes on the power of the electric field at 12 Watts.

Experimentally, a certain sensitivity of the PERV-C system on DNA samples of large white pigs (whose individuals, according to literature data, are predominantly carriers of the retrovirus subtype C), was detected using an already optimized and exhaust PCR scheme in the multiplex system. It has been shown that the dilution of the output DNA sample (1:1 to 152 ng / μl) to 1:10000 (15.2 pg / μl) is the maximum permissible for the detection of multiplex PCR PERV-C-α-Actin by the method of horizontal electrophoresis of 2% agarose gel.

According to the results of molecular-genetic genetic research, a system for diagnosing animal carriers of endogenous retrovirus of pigs of subtype C was developed using multiplex PCR-SSPPERV-C-α-Actin. The development and optimization of the genotyping technique for Vietnamese Meyshan pigs and Big White pigs determined the optimal parameters of PCR scheme, amplification program and modes of electrophoretic separation of fragments with their subsequent visualization, and also allowed to determine the maximum permissible concentration of DNA for PCR, which was 15.2 pg / μl, and the minimum amount of PCR product for its visualization is 5 × 103 copies.

References

1. Zinoveva, N. A., A. V. Melerzanov, E. V. Petersen, N. Klimyuk, N. A. Volkova, A. S. Duh, Н. A. Trusova, E. Volf, and G. Brem. 2014. Ispolzovanie transennyih Gal-ko sviney v ksenotrans- plantatsii: problemyi i perspektivyi – The use of transgenic Gal-ko pigs in xenotransplantation: problems and perspectives. Selskohozyaystvennaya biologiya – Agricultural Biology, 2:42–49 (in Russian).

2. Maniatis, T., E. Frich, and D. Sembruk. 1984. Molekulyarnoe klonirovanie – Molecular cloning. Moscow, Mir, 479 (in Russian).

3. Aytnazarov, R. B., N. S. Yudin, R. S. Kirilchuk, N. N. Kochnev, S. P. Knyazev, аnd M. I. Voevoda. 2016. Opredelenie chisla kopiy endogennyih retrovirusov tipa A u domashnih sviney i dikih kabanov – Determination of the copy numbers of type A porcine endogenous retroviruses in domestic pigs and wild boars. Vavilovskiy zhurnal genetiki i selektsii – Vavilov Journal of Genetics and Breeding. 20(6):756–761 (in Russian).

4. Ryabinin, V. E. 2015. Problemyi i perspektivyi sozdaniya ekstrakorporalnyih sistem pod- derzhki funktsionalnogo sostoyaniya pecheni – Problems and prospects of creating extracorporeal systems to support the functional state of the liver. Biomeditsinskaya himiya – Biomedical chemistry, 61(5):545–559 (in Russian).

5. Skaletskiy, N. N. 1985. Vliyanie kultivirovaniya ostrovkovyih kletok podzheludochnoy zhelezyi na ih vyizhivanie v organizme ksenogennogo retsipienta – Influence of cultivation of islet cells of the pancreas on their survival in the organism of the xenogeneic recipient. Transplantatsiya organov – Оrgan transplantation. Kyiv, Kolos, 219–220 (in Russian).

6. Sokolov, V. P., and V. V. Dzhemelinskiy. 1989. Vyidelenie vyisokomolekulyarnoy eukarioticheskoy DNK s ispolzovaniem atsetata kaliya – Isolation of high molecular eukaryotic DNA using potassium acetate. Molekulyarnaya genetika, mikrobiologiya i virusologiya. – Molecular genetics, microbiology and virology. 6:45–46 (in Russian).

7. Yudin, N. S., R. B. Aytnazarov, and V. I. Ermolaev. 2011. Endogennyie retrovirusyi svini: naskolko velik risk infektsii pri ksenotransplantatsii? – Endogenous retroviruses of pig: how great is the risk of infection with xenotransplantation. Vavilovskiy zhurnal genetiki i selektsii – Vavilov Journal of Genetics and Breeding. 15(2):340–350 (in Russian).

8. Guo, Fei., Xiaowei Xing, Wayne J. Hawthorne, Qiong Dong, Bin Ye, Juan Zhang, Qi Liang, and Wei Nie. 2014. Characterization of PERV in a new conserved pig herd as potential donor animals for xenotransplantation in China. Virology Journal. 11:212–221 (in English).

9. Chak-Sum, Ho., S Erin, P. Rochelle, W. Gregory, M. Martens, B. Lawrence, J. Schook, M. Douglas, and M. Smith. 2006. Characterization of swine leukocyte antigen polymorphism bysequence-based and PCR-SSP methods in Meishan pigs. Immunogenetics. 58(11):873–882 (in English).

10. Windt, D. J., R. Bottino, G. Kumar, M. Wijkstrom, H. Hara, M. Ezzelarab, B. Ekser, C. Phelps, M. Murase, A. Casu, D. Ayares, G. Fadi, R. Lakkis, M. Trucco, and D. Cooper. 2012. Clinical Islet Xenotransplantation How Close Are We? Diabetes. 61(12):3046–3055 (in English).

11. Giraud, S., F. Favreau, N. Chatauret, R. Thuillier, S. Maiga, and T. Hauet. 2011. Contribution of Large Pig for Renal Ischemia-Reperfusion and Transplantation Studies: The Preclinical Model. Biomedicine and Biotechnology. 2011:1–14 (in English).

12. Harrison, I., Y. Takeuchi, B. Bartosch, and J. P. Stoye. 2004. Determinants of high titer in recombinant porcine endogenous retroviruses. J. Virol. 78:13871–13879 (in English).

13. Elliott, R. B. 2011. Living Cell Technologies Towards xenotransplantation of pig islets in the clinic. Curr Opin Organ Transplant. 6:195–200 (in English).

14. Groth, C. G., O. Korsgren, and A. Tibell. 1994. Transplantation of porcine fetal pancreas to diabetic patients. Lancet, 344:1402–1404 (in English).

15. Meije, Y., R. R. Tonjes, and J. A. Fishman. 2010. Retroviral restriction factors and infectious risk in xenotransplantation. Am. J. Transplant. 10(7):1511–1516 (in English).

16. Nikitin, S. V., N. S. Yudin, and S. P. Knyazev. 2010. Differentiation of wild boar and domestic pig populations based on the frequency of chromosomes carrying endogenous retroviruses. Nat. sci. 2(6):527–534 (in English).

17. Kimsa, M. C., B. Strzalka-Mrozik, M. W. Kimsa, J. Gola, P. Nicholson, K. Lopata, and U. Mazurek. 2014. Porcine endogenous retroviruses in xenotransplantation – molecular aspects. Viruses. 6(5):2062–2083 (in English).

18. Fink, J. S., J. M. Schumacher, S. L. Ellias, E. P. Palmer, M. SaintHilaire, K. Shannon, R. Penn, P. Starr, C. Van Horne, H. S. Kott, P. K. Dempsey, A. J. Raineri, C. Manhart, J. Dinsmore, and O. Isacson. 2000. Porcine xenografts in Parkinson's disease and Huntington's disease patients: preliminary results. Cell Transplant. 9(2):273–278 (in English).

19. Shimatsu, Y., K. Yamada, W. Horii, A. Hirakata, Y. Sakamoto, S. Waki, J. Sano, T. Saitoh, H. Sahara, A. Shimizu, H. Yazawa, D. H. Sachs, and T. Nunoya. 2013. Production of cloned NIBS (Nippon Institute for Biological Science) and α-1, 3-galactosyltransferase knockout MGH miniature pigs by somatic cell nuclear transfer using the NIBS breed as surrogates. Xenotransplantation. 20(3):157–164 (in English).

20. Stephenson, F. H. 2003. Calculations for Molecular Biology and Biotechnology. A Guide to Mathematics in the Laboratory. Elsevier Inc, 302 (in English).

21. Hering, B. J., D. K. Cooper, E. Cozzi, H. J. Schuurman, G. S. Korbutt, J. Denner, P. J. O’Connell, H. Y. Vanderpool, and R. N. Pierson. 2009. The international xenotransplantation association consensus statement on conditions for undertaking clinical trials of porcine islet products in type 1 diabetes–executive summary. Xenotransplantation. 16:196–202 (in English).

22. Valdés-González, R. A., L. M. Dorantes, and G. N. Garibay. 2005. Xenotransplantation of porcine neonatal islets of Langerhans and Sertoli cells: a 4-year study. Eur J Endocrinol. 153:419–427(in English).
Published
2018-05-15
How to Cite
Ryk, T. M., Metlytska, O. I., & Nor, V. Y. (2018). Development of the identification’s method of porcine endogenous retroviruses PERV-С. Animal Breeding and Genetics, 55, 167-178. https://doi.org/10.31073/abg.55.24